Благодаря развитию биотехнологий, цитологии и генетики, в последние десятилетия стали возможны удивительные операции над ДНК живых организмов. К ним относятся ряд удачных проектов по клонированию, генной терапии, расшифровки генома человека. Биотехнологии развиваются стремительно, и открывают все новые возможности и точки приложения. Одна из таких возможностей это создание нанокомпьютеров из компонентов живых клеточных органелл. Другая, не менее важная, это обработка массива расшифрованных генов человека математическими методами.

А все началось с того, что один из основателей нанокомпьютеров, физик Ричард Фейнман (Richard Feynman, Калифорнийский Технологический Университет) предложил 1000$ первому, кто
сможет разместить текст одного печатного листа на площади менее чем 1/25000 миллиметра. А также еще 1000$ любому, кто сумеет соорудить электромотор, занимающий куб объемом менее 1/64 дюйма. С того самого момента многие исследователи обратили свое внимание на область нанотехнологий. 

Нанотехнология это технология проектирования и сборки конструкций размером в нанометры и
биокомпьютеры один из продуктов данной технологии. Для справки, нанометр равен 10-9 метра, расстояние примерно в 10 атомных радиусов. Биохимические компьютеры это разновидность нанокомпьютеров, отличительная способность их в том что информация представлена путем образования и разрыва химических связей. В результате биохимические молекулы способны на простейшие логические операции. Нанотехнологии очень важны по многим причинам. Еще в 1965 году Гордон Мур основатель корпорации Intel предсказал, что количество транзисторов в микросхемах будет удваиваться год от года, и во многом был прав. Такая тенденция продолжается и сейчас, хотя нынешняя технология себя уже почти исчерпала. Поэтому многие ученые усматривают в нанотехнологиях альтернативу современным компьютерам. Наиболее яркий пример нанокомпьютера это живая клетка. С помощью клеточной хирургии врачи и фармакологи смогли модифицировать клеточные структуры для производства медикаментов, например Инсулина. Собранные по такой технологии нанокомпьютеры могли бы найти свое место в селективной очистке тканей организма от антигенов.
Тем не менее, до создания таких удивительных приборов еще далеко, это пока лишь теория. На сегодняшний день биохимический компьютер единственный из экспериментально созданных нанокомпьютеров. Экономическая оправданность производства компьютеров на молекулярном уровне пока еще, по большей части, тоже теоретическая.

Одним из первых биокомпьютеров, основанных на ДНК, был нанокомпьютер созданный в 1994 году Леонардом Адельманом. Адельман использовал кусочки ДНК для правильного решения задачи о графах. Он так же предполагал использовать биокомпьютер для решения некоторых задач из комбинаторики, в частности, для взламывания шифров. Компьютер такого типа производил вычисления во многом
благодаря высокой параллельности вычислений на ДНК.
Но, у заманчивой идеи биокомпьютера, есть очень много сложностей в его конструировании. Не говоря уже о промышленном изготовлении. Одна из них, это наличие теплового движения молекул Броуна, которое приводит к тому, что составные части такого компьютера будут, как бы разбегаться в стороны. Конструкция будет не устойчивой. Если же процесс вычислений проводить в растворе, то еще более усилится проблема связи с электронными компонентами биокомпьютера, а значит производительность его будет падать. Другая проблема в том, что биокомпьютер должен оперировать цифрами (байтами, битами) а не нуклеиновыми основаниями, и при этом иметь достаточную память. Вполне возможно, что эти трудности удастся преодолеть лишь частично, а до вычислительной мощи и экономической выгоды кремниевых машин, биокомпьютеру не добраться. Но необязательно применять ДНК как процессор, на данный момент можно использовать ее как носитель информации. Причем двух типов: динамической и постоянной. 

База данных на ДНК

Несмотря на достаточно специфичный круг задач, решаемых с помощью ДНК, некоторые авторы предлагают рассматривать ДНК не как счетное устройство, а как перспективный носитель информации.
ДНК самой природой заложено быть таким носителем. Только вся проблема в том, что информация, на ней записанная, изначально не предусматривала цифровой стандарт. Но это не помешало исследователям из Калифорнийского университета и Университета Южной Калифорнии во главе с Сэмом Ровэйсом выдвинуть интересную идею. Она заключается в том, чтобы создать ДНК память с возможностью перезаписи, т.е. ДНК-RAM.

Основная идея заключается в том, чтобы кодировать состояния бита наличием или отсутствием комплиментарной цепочки.
Для работы данного метода необходимо: задать произвольную длину отрезка ДНК (допустим X нуклеотидов), который будет представлять один бит. Что бы обеспечить память в Y бит, нужно синтезировать цепочку из X * Y нуклеотидов. Причем каждый отрезок из X оснований должен иметь уникальную комбинацию. Теперь если нужно установить бит на 1, к его отрезку следует присоединить дополнение — комплиментарный отрезок или стикер. 

Такая процедура обеспечивает побайтовую адресацию данных и предполагает некоторые бинарные операции. Сброс всех битов в нулевое состояние достигается простым нагреванием, а обнуление одного бита с помощью более сложной процедуры. Для этого применяют цепочку нуклеотидов идентичных данному стикеру, но с другой основой (RNA). При этом образуются участки тройной (!) спирали ДНК, которая гораздо менее устойчива, и при нагревании распадается. При этом будут обнулены только нужные биты.

Это прототип ДНК флэш-памяти и возможно он будет использован в нанокомпьютерах будущего. Но на сколько это целесообразно? Ведь для такой памяти очень важна скорость чтения/записи, а здесь она как раз страдает. Сначала создать уникальную матрицу, затем вводить раствор ингредиентов, анализ изменений и т.д. Да и зачем заставлять ДНК выполнять не свойственную ей роль — оперативной памяти, когда в природе она «ROM — только для чтения». 

Собственные исследования

Основной целью исследования было создание нового метод записи данных на ДНК, который обеспечивал гораздо большую плотностью записи, чем у вышеописанный. Для реализации он не должен был требовать каких либо нестандартных технологических приемов. Одной из перспектив применения метода можно будет считать действующий ДНК — ROM. 

Метод Нуклеографии

Начнем с того, что информация имеет в своей основе бит. Бит может быть равен 1 либо 0, бит это минимальная порция информации, ее элементарная частица. Любую информацию можно представить в виде битов. На этом основаны все цифровые методы записи: состояние триггера в микросхеме, или магнитных зерен на поверхности дискеты, отражают состояния бита 1 или 0. В ДНК прослеживается та же система. Нуклеотиды можно рассматривать как числа. Дело в том, что нуклеотиды А, G, T, C, имеют каждый свой определенный информационный эквивалент, причем равный паре бит!

Нуклеотид Сокращение Двоичный эквивалент
Гуанин G 00
Аденин A 01
Тимин T 10
Цитозин C 11

Допустим А = 01 (в двоичной системе), тогда комплиментарный ему Т = 10, G = 00 и С = 11. Иначе говоря получается четвертичная система исчисления.

Для примера возьмем 1 байт в десятичной системе = 145 в двоичной 10010001 и запишем его в формате ДНК! Сначала, разобьем 8 бит по парам 10, 01, 00, 01 Всего пар 4, значит для записи нам нужно будет 4 нуклеотида. Сверяясь с таблицей запишем их: Т(10), А(01), G(00), A(01) Получается олигонуклиотид: TAGA Система работает в обе стороны и вы можете получить из ДНК (TAGA) байт равный 145.
Ну а раз мы уже смогли записать и прочесть байт, то, по той же схеме, в принципе, можно записать и большее количество информации! Для таких целей была составлена специальная
программа.

Вот к примеру данная последовательность: 

CACACCGTCTCTGTGGCCGACTCTCTCTCTG ACCTACTAACTCACTTGCTAAGTGGGTGGCT
ACCTGGCTCCCTTGCCGACTGGCTCACTCTG TGGCTCACTGGGTGGCGAGCGCACGTTGTGA

Преобразовав эту запись методом нуклеографического алгоритма вы получите следующую байтовую последовательность: 

Текст DEC HEX# DNA
1 Э 221 DD CACA
2 т 242 F2 CCGT
3 о 238 EE CTCT
4   32 20 GTGG
5 с 241 F1 CCGA
6 о 238 EE CTCT
7 о 338 EE CTCT
8 б 225 E1 CTGA
9 щ 249 F9 CCTA
10 е 229 E5 CTAA
11 н 237 ED CTCA

В привычном для пользователей, текстовом формате, это означает:
«Это сообщение записано на ДНК!»

При этом, если синтезировать молекулу ДНК с данной записью, то она была бы в длину менее 700 Ангстрем, что гораздо меньше любой бактерии или вируса! Это была бы запись на молекулярном уровне! 

При этом в формат ДНК можно перевести любой файл, графику, звукозапись, таблицу и т. д., и гарантировано расшифровать его обратно. На данный момент, по разработанному методу, в лаборатории удалось реально записать на молекулу ДНК файл размером 8 байт. Образец хранится в пластиковой пробирке. Этот олигонуклиотид состоит из следующих последовательностей.

5′-AAGCATTGACAAATCAATTAATCGATCCACAT

в переводе на цифровой формат содержит текст — «Shumilov»

Последствия

Таким образом возможно создание носителей данных с молекулярными размерами. Но есть одно существенное препятствие — более длинные цепочки трудно синтезировать и они более подвержены повреждениям, чем короткие. Поэтому, для записи больших файлов, целесообразно использовать короткие цепочки — олигонуклеотиды, предварительно разбив информацию на кластеры. Такая технология уже есть и называется NGFS — (Нуклеографическая файловая система). Суть ее состоит в разделении олигонуклеотида на две части, служебную и файловую. Благодаря информации из служебной части, компьютер будет знать к какому сегменту принадлежит информация из файловой части. Таким образом, по моим расчетам, можно записать до 6 Кб (при максимальной длине кластера равной 100 нуклеотид) а теоретически и 1.43 Мб. Следующим шагом будет создание компактного прибора для чтения и записи ДНК.

Есть еще одна интересная, на мой взгляд, область для исследований. Я имею в виду недавно расшифрованный геном человека. Расшифрована только нуклеотидная последовательность генов. Остается много мест, генетическая принадлежность которых не ясна. Я предлагаю перевести интересующие участки хромосом в цифровой формат и проводить анализ полученных данных математическими алгоритмами. Возможно, это откроет какие либо закономерности ранее не известные науке.

Оставить мнение

Check Also

Алмазный фонд «Хакера». Важные материалы по взлому за последние несколько лет

В прошлом выпуске мы сделали подборку по реверсингу и анализу malware-кода, которая в перв…